This is cutadapt 2.10 with Python 3.8.3
Command line parameters: --cores=0 -g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA;max_error_rate=0 --overlap 5 -o ../trimmed_reads/V10F24-111_A1_S1_L001_R2_001.fastq.gz -n 2 merged_V10F24-111_A1_S1_R2.fastq.gz
Processing reads on 8 cores in single-end mode ...
Finished in 558.68 s (8 us/read; 7.16 M reads/minute).

=== Summary ===

Total reads processed:              66,695,418
Reads with adapters:                65,131,496 (97.7%)
Reads written (passing filters):    66,695,418 (100.0%)

Total basepairs processed: 8,003,450,160 bp
Total written (filtered):  3,062,267,938 bp (38.3%)

=== Adapter 1 ===

Sequence: AAGCAGTGGTATCAACGCAGAGTACATGGG; Type: non-internal 5'; Length: 30; Trimmed: 29873468 times

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30 bp: 3

Overview of removed sequences
length	count	expect	max.err	error counts
5	15168	65132.2	0	15168
6	9006	16283.1	0	9006
7	8435	4070.8	0	8435
8	2603	1017.7	0	2603
9	567	254.4	0	391 176
10	2426	63.6	1	729 1697
11	17487	15.9	1	12723 4764
12	3471	4.0	1	1240 2231
13	5487	1.0	1	4136 1351
14	3592	0.2	1	1432 2160
15	3734	0.1	1	1150 2584
16	8086	0.0	1	4532 3554
17	7588	0.0	1	2395 5193
18	7500	0.0	1	2410 5016 74
19	6679	0.0	1	1037 3790 1852
20	16179	0.0	2	7624 5477 3078
21	33588	0.0	2	14624 12079 6885
22	27670	0.0	2	9564 10397 7709
23	47204	0.0	2	19649 16196 11359
24	44645	0.0	2	15931 15124 13590
25	109987	0.0	2	30353 38695 40939
26	282161	0.0	2	19759 81655 180747
27	2932129	0.0	2	47661 237775 360884 2285809
28	1880054	0.0	2	427273 502433 685741 264607
29	2808072	0.0	2	118503 755883 1223954 709732
30	13441603	0.0	3	3673983 2029289 4108329 3630002
31	4922663	0.0	3	0 1042981 1356929 2522753
32	2174073	0.0	3	0 0 847970 1326103
33	1051611	0.0	3	0 0 0 1051611


=== Adapter 2 ===

Sequence: AAAAAAAAAA; Type: regular 3'; Length: 10; Trimmed: 59653303 times

No. of allowed errors:
0-10 bp: 0

Bases preceding removed adapters:
  A: 0.0%
  C: 36.0%
  G: 28.6%
  T: 35.4%
  none/other: 0.0%

Overview of removed sequences
length	count	expect	max.err	error counts
5	151868	65132.2	0	151868
6	123985	16283.1	0	123985
7	115151	4070.8	0	115151
8	114608	1017.7	0	114608
9	117537	254.4	0	117537
10	114568	63.6	0	114568
11	118277	63.6	0	118277
12	123282	63.6	0	123282
13	128247	63.6	0	128247
14	130839	63.6	0	130839
15	132786	63.6	0	132786
16	142866	63.6	0	142866
17	141551	63.6	0	141551
18	149416	63.6	0	149416
19	152406	63.6	0	152406
20	157014	63.6	0	157014
21	159239	63.6	0	159239
22	169365	63.6	0	169365
23	167696	63.6	0	167696
24	182142	63.6	0	182142
25	181737	63.6	0	181737
26	192813	63.6	0	192813
27	191586	63.6	0	191586
28	210503	63.6	0	210503
29	211563	63.6	0	211563
30	219186	63.6	0	219186
31	227613	63.6	0	227613
32	237378	63.6	0	237378
33	248154	63.6	0	248154
34	253990	63.6	0	253990
35	259968	63.6	0	259968
36	261315	63.6	0	261315
37	280635	63.6	0	280635
38	295702	63.6	0	295702
39	313139	63.6	0	313139
40	328334	63.6	0	328334
41	334017	63.6	0	334017
42	338841	63.6	0	338841
43	342005	63.6	0	342005
44	371256	63.6	0	371256
45	375854	63.6	0	375854
46	397951	63.6	0	397951
47	414669	63.6	0	414669
48	411944	63.6	0	411944
49	438129	63.6	0	438129
50	459683	63.6	0	459683
51	489271	63.6	0	489271
52	507487	63.6	0	507487
53	526602	63.6	0	526602
54	537603	63.6	0	537603
55	563024	63.6	0	563024
56	597022	63.6	0	597022
57	610239	63.6	0	610239
58	656305	63.6	0	656305
59	695359	63.6	0	695359
60	712552	63.6	0	712552
61	739469	63.6	0	739469
62	766729	63.6	0	766729
63	795267	63.6	0	795267
64	857324	63.6	0	857324
65	952309	63.6	0	952309
66	972048	63.6	0	972048
67	987744	63.6	0	987744
68	1051987	63.6	0	1051987
69	1133140	63.6	0	1133140
70	1120119	63.6	0	1120119
71	1196936	63.6	0	1196936
72	1239153	63.6	0	1239153
73	1350549	63.6	0	1350549
74	1546217	63.6	0	1546217
75	1588897	63.6	0	1588897
76	1510374	63.6	0	1510374
77	1727360	63.6	0	1727360
78	1850764	63.6	0	1850764
79	1786261	63.6	0	1786261
80	1727448	63.6	0	1727448
81	1690123	63.6	0	1690123
82	1911625	63.6	0	1911625
83	2081479	63.6	0	2081479
84	1946300	63.6	0	1946300
85	2174173	63.6	0	2174173
86	1605596	63.6	0	1605596
87	1933387	63.6	0	1933387
88	2350397	63.6	0	2350397
89	607041	63.6	0	607041
90	639186	63.6	0	639186
91	96440	63.6	0	96440
92	56643	63.6	0	56643
93	85720	63.6	0	85720
94	83866	63.6	0	83866
95	37053	63.6	0	37053
96	24612	63.6	0	24612
97	32320	63.6	0	32320
98	17533	63.6	0	17533
99	204115	63.6	0	204115
100	17412	63.6	0	17412
101	12554	63.6	0	12554
102	53971	63.6	0	53971
103	10165	63.6	0	10165
104	8234	63.6	0	8234
105	2618	63.6	0	2618
106	10614	63.6	0	10614
107	61756	63.6	0	61756
108	105730	63.6	0	105730
109	28368	63.6	0	28368
110	34130	63.6	0	34130
111	40987	63.6	0	40987
112	24410	63.6	0	24410
113	15038	63.6	0	15038
114	30820	63.6	0	30820
115	9684	63.6	0	9684
116	32109	63.6	0	32109
117	9472	63.6	0	9472
118	9228	63.6	0	9228
119	9170	63.6	0	9170
120	162857	63.6	0	162857
