This is cutadapt 2.10 with Python 3.8.3
Command line parameters: --cores=0 -g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA;max_error_rate=0 --overlap 5 -o ../trimmed_reads/V10F24-111_B1_S2_L001_R2_001.fastq.gz -n 2 merged_V10F24-111_B1_S2_R2.fastq.gz
Processing reads on 8 cores in single-end mode ...
Finished in 493.80 s (7 us/read; 8.22 M reads/minute).

=== Summary ===

Total reads processed:              67,689,807
Reads with adapters:                67,020,146 (99.0%)
Reads written (passing filters):    67,689,807 (100.0%)

Total basepairs processed: 8,122,776,840 bp
Total written (filtered):  2,170,843,427 bp (26.7%)

=== Adapter 1 ===

Sequence: AAGCAGTGGTATCAACGCAGAGTACATGGG; Type: non-internal 5'; Length: 30; Trimmed: 29523187 times

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30 bp: 3

Overview of removed sequences
length	count	expect	max.err	error counts
5	9276	66103.3	0	9276
6	10116	16525.8	0	10116
7	9929	4131.5	0	9929
8	3156	1032.9	0	3156
9	585	258.2	0	451 134
10	2770	64.6	1	800 1970
11	18611	16.1	1	13309 5302
12	4152	4.0	1	1263 2889
13	7155	1.0	1	5327 1828
14	4200	0.3	1	1604 2596
15	4580	0.1	1	1388 3192
16	9870	0.0	1	5620 4250
17	8373	0.0	1	2470 5903
18	8535	0.0	1	2201 6271 63
19	8002	0.0	1	1506 4891 1605
20	18347	0.0	2	7757 6846 3744
21	41898	0.0	2	18749 14797 8352
22	33739	0.0	2	11662 12464 9613
23	58141	0.0	2	24947 19063 14131
24	52209	0.0	2	19542 17525 15142
25	129308	0.0	2	33247 45597 50464
26	306937	0.0	2	24097 92586 190254
27	2057010	0.0	2	72430 241921 398041 1344618
28	1767317	0.0	2	468403 561137 513117 224660
29	2793740	0.0	2	101806 633821 1223548 834565
30	12758736	0.0	3	2307446 1490215 4013345 4947730
31	4498702	0.0	3	0 867556 1210719 2420427
32	3680383	0.0	3	0 0 1275646 2404737
33	1217410	0.0	3	0 0 0 1217410


=== Adapter 2 ===

Sequence: AAAAAAAAAA; Type: regular 3'; Length: 10; Trimmed: 64385626 times

No. of allowed errors:
0-10 bp: 0

Bases preceding removed adapters:
  A: 0.0%
  C: 18.8%
  G: 56.8%
  T: 24.5%
  none/other: 0.0%

Overview of removed sequences
length	count	expect	max.err	error counts
5	57107	66103.3	0	57107
6	48518	16525.8	0	48518
7	43379	4131.5	0	43379
8	43843	1032.9	0	43843
9	46451	258.2	0	46451
10	44164	64.6	0	44164
11	43842	64.6	0	43842
12	45512	64.6	0	45512
13	46182	64.6	0	46182
14	49542	64.6	0	49542
15	54577	64.6	0	54577
16	56126	64.6	0	56126
17	53751	64.6	0	53751
18	56075	64.6	0	56075
19	57236	64.6	0	57236
20	57043	64.6	0	57043
21	57135	64.6	0	57135
22	63303	64.6	0	63303
23	63408	64.6	0	63408
24	65150	64.6	0	65150
25	68366	64.6	0	68366
26	71463	64.6	0	71463
27	70709	64.6	0	70709
28	78354	64.6	0	78354
29	88899	64.6	0	88899
30	90449	64.6	0	90449
31	90603	64.6	0	90603
32	90118	64.6	0	90118
33	92811	64.6	0	92811
34	94852	64.6	0	94852
35	100669	64.6	0	100669
36	101042	64.6	0	101042
37	106519	64.6	0	106519
38	106499	64.6	0	106499
39	118555	64.6	0	118555
40	117637	64.6	0	117637
41	122150	64.6	0	122150
42	125717	64.6	0	125717
43	130321	64.6	0	130321
44	140640	64.6	0	140640
45	151489	64.6	0	151489
46	155132	64.6	0	155132
47	158932	64.6	0	158932
48	163105	64.6	0	163105
49	172931	64.6	0	172931
50	190612	64.6	0	190612
51	196781	64.6	0	196781
52	200817	64.6	0	200817
53	229438	64.6	0	229438
54	235514	64.6	0	235514
55	242550	64.6	0	242550
56	251695	64.6	0	251695
57	265120	64.6	0	265120
58	286239	64.6	0	286239
59	302588	64.6	0	302588
60	344893	64.6	0	344893
61	332987	64.6	0	332987
62	351693	64.6	0	351693
63	376937	64.6	0	376937
64	405757	64.6	0	405757
65	470450	64.6	0	470450
66	477530	64.6	0	477530
67	515823	64.6	0	515823
68	596107	64.6	0	596107
69	643567	64.6	0	643567
70	682876	64.6	0	682876
71	772137	64.6	0	772137
72	891416	64.6	0	891416
73	882472	64.6	0	882472
74	1125235	64.6	0	1125235
75	1161423	64.6	0	1161423
76	1036326	64.6	0	1036326
77	1213850	64.6	0	1213850
78	1475558	64.6	0	1475558
79	1627059	64.6	0	1627059
80	1748318	64.6	0	1748318
81	1880630	64.6	0	1880630
82	2559107	64.6	0	2559107
83	3073770	64.6	0	3073770
84	3001312	64.6	0	3001312
85	3802846	64.6	0	3802846
86	3787122	64.6	0	3787122
87	5973584	64.6	0	5973584
88	10286970	64.6	0	10286970
89	2842333	64.6	0	2842333
90	1782494	64.6	0	1782494
91	335344	64.6	0	335344
92	173728	64.6	0	173728
93	162627	64.6	0	162627
94	106126	64.6	0	106126
95	80250	64.6	0	80250
96	25384	64.6	0	25384
97	45549	64.6	0	45549
98	25742	64.6	0	25742
99	204234	64.6	0	204234
100	20847	64.6	0	20847
101	11512	64.6	0	11512
102	63506	64.6	0	63506
103	10813	64.6	0	10813
104	8723	64.6	0	8723
105	2377	64.6	0	2377
106	9191	64.6	0	9191
107	54561	64.6	0	54561
108	124303	64.6	0	124303
109	26733	64.6	0	26733
110	40027	64.6	0	40027
111	46633	64.6	0	46633
112	28228	64.6	0	28228
113	13763	64.6	0	13763
114	38977	64.6	0	38977
115	9386	64.6	0	9386
116	50679	64.6	0	50679
117	9560	64.6	0	9560
118	9255	64.6	0	9255
119	9992	64.6	0	9992
120	253334	64.6	0	253334
