This is cutadapt 2.10 with Python 3.8.3
Command line parameters: --cores=0 -g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA;max_error_rate=0 --overlap 5 -o ../trimmed_reads/V10F24-111_D1_S4_L001_R2_001.fastq.gz -n 2 merged_V10F24-111_D1_S4_R2.fastq.gz
Processing reads on 8 cores in single-end mode ...
Finished in 1615.87 s (9 us/read; 6.74 M reads/minute).

=== Summary ===

Total reads processed:             181,600,768
Reads with adapters:               169,944,375 (93.6%)
Reads written (passing filters):   181,600,768 (100.0%)

Total basepairs processed: 21,792,092,160 bp
Total written (filtered):  11,031,513,879 bp (50.6%)

=== Adapter 1 ===

Sequence: AAGCAGTGGTATCAACGCAGAGTACATGGG; Type: non-internal 5'; Length: 30; Trimmed: 119081795 times

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30 bp: 3

Overview of removed sequences
length	count	expect	max.err	error counts
5	155082	177344.5	0	155082
6	25703	44336.1	0	25703
7	25108	11084.0	0	25108
8	8915	2771.0	0	8915
9	2516	692.8	0	1373 1143
10	7657	173.2	1	2587 5070
11	42009	43.3	1	32952 9057
12	8241	10.8	1	3442 4799
13	17855	2.7	1	14347 3508
14	10081	0.7	1	4962 5119
15	9763	0.2	1	4063 5700
16	22937	0.0	1	14341 8596
17	25438	0.0	1	9248 16190
18	24041	0.0	1	8245 15596 200
19	16114	0.0	1	2981 10277 2856
20	52317	0.0	2	28201 16078 8038
21	64542	0.0	2	26104 24409 14029
22	73384	0.0	2	18128 31767 23489
23	210951	0.0	2	94129 72065 44757
24	124111	0.0	2	22684 43510 57917
25	764585	0.0	2	208789 276966 278830
26	1355305	0.0	2	117708 538593 699004
27	8735098	0.0	2	247173 1101919 1879733 5506273
28	9073290	0.0	2	2762106 3054811 2600911 655462
29	12627049	0.0	2	992513 4276763 5156023 2201750
30	59047371	0.0	3	22641182 9373072 15362342 11670775
31	12766266	0.0	3	0 3989797 3557325 5219144
32	8832556	0.0	3	0 0 4239177 4593379
33	4953510	0.0	3	0 0 0 4953510


=== Adapter 2 ===

Sequence: AAAAAAAAAA; Type: regular 3'; Length: 10; Trimmed: 120231484 times

No. of allowed errors:
0-10 bp: 0

Bases preceding removed adapters:
  A: 0.0%
  C: 35.2%
  G: 29.4%
  T: 35.4%
  none/other: 0.0%

Overview of removed sequences
length	count	expect	max.err	error counts
5	914250	177344.5	0	914250
6	690437	44336.1	0	690437
7	617565	11084.0	0	617565
8	587731	2771.0	0	587731
9	606656	692.8	0	606656
10	578727	173.2	0	578727
11	583057	173.2	0	583057
12	596003	173.2	0	596003
13	614101	173.2	0	614101
14	617213	173.2	0	617213
15	657553	173.2	0	657553
16	635544	173.2	0	635544
17	655331	173.2	0	655331
18	688050	173.2	0	688050
19	686745	173.2	0	686745
20	667602	173.2	0	667602
21	678778	173.2	0	678778
22	730820	173.2	0	730820
23	693849	173.2	0	693849
24	727238	173.2	0	727238
25	743838	173.2	0	743838
26	769206	173.2	0	769206
27	774752	173.2	0	774752
28	868546	173.2	0	868546
29	816410	173.2	0	816410
30	825785	173.2	0	825785
31	839407	173.2	0	839407
32	816115	173.2	0	816115
33	844803	173.2	0	844803
34	870131	173.2	0	870131
35	848690	173.2	0	848690
36	857477	173.2	0	857477
37	898201	173.2	0	898201
38	929510	173.2	0	929510
39	941860	173.2	0	941860
40	969636	173.2	0	969636
41	985643	173.2	0	985643
42	953336	173.2	0	953336
43	990436	173.2	0	990436
44	1024970	173.2	0	1024970
45	1042968	173.2	0	1042968
46	1086607	173.2	0	1086607
47	1096843	173.2	0	1096843
48	1105417	173.2	0	1105417
49	1162126	173.2	0	1162126
50	1179497	173.2	0	1179497
51	1200410	173.2	0	1200410
52	1228898	173.2	0	1228898
53	1257012	173.2	0	1257012
54	1269390	173.2	0	1269390
55	1329211	173.2	0	1329211
56	1353780	173.2	0	1353780
57	1379709	173.2	0	1379709
58	1400553	173.2	0	1400553
59	1431256	173.2	0	1431256
60	1529988	173.2	0	1529988
61	1547466	173.2	0	1547466
62	1504638	173.2	0	1504638
63	1617962	173.2	0	1617962
64	1687920	173.2	0	1687920
65	1752765	173.2	0	1752765
66	1964662	173.2	0	1964662
67	1899278	173.2	0	1899278
68	2075073	173.2	0	2075073
69	2132121	173.2	0	2132121
70	2055494	173.2	0	2055494
71	2345442	173.2	0	2345442
72	2459853	173.2	0	2459853
73	2302118	173.2	0	2302118
74	2692592	173.2	0	2692592
75	2575478	173.2	0	2575478
76	2274451	173.2	0	2274451
77	2527391	173.2	0	2527391
78	2739186	173.2	0	2739186
79	2511620	173.2	0	2511620
80	2479060	173.2	0	2479060
81	2347793	173.2	0	2347793
82	2683238	173.2	0	2683238
83	3062106	173.2	0	3062106
84	2948986	173.2	0	2948986
85	3202508	173.2	0	3202508
86	2540309	173.2	0	2540309
87	2791483	173.2	0	2791483
88	3368885	173.2	0	3368885
89	833754	173.2	0	833754
90	458571	173.2	0	458571
91	124445	173.2	0	124445
92	76199	173.2	0	76199
93	116385	173.2	0	116385
94	134852	173.2	0	134852
95	45555	173.2	0	45555
96	29633	173.2	0	29633
97	55446	173.2	0	55446
98	25577	173.2	0	25577
99	307531	173.2	0	307531
100	25049	173.2	0	25049
101	15594	173.2	0	15594
102	71890	173.2	0	71890
103	11962	173.2	0	11962
104	13439	173.2	0	13439
105	3417	173.2	0	3417
106	10075	173.2	0	10075
107	62992	173.2	0	62992
108	93298	173.2	0	93298
109	36143	173.2	0	36143
110	47764	173.2	0	47764
111	47990	173.2	0	47990
112	30990	173.2	0	30990
113	18441	173.2	0	18441
114	27226	173.2	0	27226
115	10959	173.2	0	10959
116	28881	173.2	0	28881
117	12111	173.2	0	12111
118	12300	173.2	0	12300
119	12441	173.2	0	12441
120	491029	173.2	0	491029
