This is cutadapt 2.10 with Python 3.8.3
Command line parameters: --cores=0 -g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA;max_error_rate=0 --overlap 5 -o ../trimmed_reads/V10F24-110_C1_S3_L001_R2_001.fastq.gz -n 2 sample_S3_R2.fastq.gz
Processing reads on 10 cores in single-end mode ...
Finished in 486.82 s (9 us/read; 6.73 M reads/minute).

=== Summary ===

Total reads processed:              54,567,434
Reads with adapters:                53,905,923 (98.8%)
Reads written (passing filters):    54,567,434 (100.0%)

Total basepairs processed: 6,548,092,080 bp
Total written (filtered):  3,231,057,251 bp (49.3%)

=== Adapter 1 ===

Sequence: AAGCAGTGGTATCAACGCAGAGTACATGGG; Type: non-internal 5'; Length: 30; Trimmed: 52866815 times

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30 bp: 3

Overview of removed sequences
length	count	expect	max.err	error counts
5	69947	53288.5	0	69947
6	11522	13322.1	0	11522
7	11891	3330.5	0	11891
8	3080	832.6	0	3080
9	1124	208.2	0	453 671
10	3470	52.0	1	1118 2352
11	17988	13.0	1	17088 900
12	2433	3.3	1	1306 1127
13	6316	0.8	1	5697 619
14	4191	0.2	1	3764 427
15	2607	0.1	1	1715 892
16	9808	0.0	1	7301 2507
17	19439	0.0	1	16902 2537
18	13688	0.0	1	11740 1881 67
19	7690	0.0	1	5063 2423 204
20	17293	0.0	2	14533 2251 509
21	16381	0.0	2	11751 3785 845
22	41381	0.0	2	30987 8786 1608
23	65724	0.0	2	56682 6711 2331
24	37911	0.0	2	10400 22281 5230
25	255176	0.0	2	193974 50328 10874
26	368032	0.0	2	266359 77594 24079
27	831053	0.0	2	430400 327717 56969 15967
28	3261931	0.0	2	2634286 465578 154914 7153
29	5157977	0.0	2	1394865 3587687 150876 24549
30	40877896	0.0	3	39309024 1192319 283583 92970
31	661476	0.0	3	0 554167 82870 24439
32	540696	0.0	3	0 0 470360 70336
33	548694	0.0	3	0 0 0 548694


=== Adapter 2 ===

Sequence: AAAAAAAAAA; Type: regular 3'; Length: 10; Trimmed: 29946685 times

No. of allowed errors:
0-10 bp: 0

Bases preceding removed adapters:
  A: 0.0%
  C: 36.0%
  G: 32.0%
  T: 32.0%
  none/other: 0.0%

Overview of removed sequences
length	count	expect	max.err	error counts
5	270458	53288.5	0	270458
6	209991	13322.1	0	209991
7	182780	3330.5	0	182780
8	177571	832.6	0	177571
9	175773	208.2	0	175773
10	174869	52.0	0	174869
11	170154	52.0	0	170154
12	181681	52.0	0	181681
13	181818	52.0	0	181818
14	190736	52.0	0	190736
15	186630	52.0	0	186630
16	191467	52.0	0	191467
17	190832	52.0	0	190832
18	195703	52.0	0	195703
19	189546	52.0	0	189546
20	201828	52.0	0	201828
21	194463	52.0	0	194463
22	197680	52.0	0	197680
23	195459	52.0	0	195459
24	201849	52.0	0	201849
25	202725	52.0	0	202725
26	221924	52.0	0	221924
27	211529	52.0	0	211529
28	221488	52.0	0	221488
29	217636	52.0	0	217636
30	214076	52.0	0	214076
31	235763	52.0	0	235763
32	216543	52.0	0	216543
33	230706	52.0	0	230706
34	242104	52.0	0	242104
35	229607	52.0	0	229607
36	238928	52.0	0	238928
37	242706	52.0	0	242706
38	253223	52.0	0	253223
39	252044	52.0	0	252044
40	263733	52.0	0	263733
41	290488	52.0	0	290488
42	283782	52.0	0	283782
43	268471	52.0	0	268471
44	273069	52.0	0	273069
45	268466	52.0	0	268466
46	341487	52.0	0	341487
47	274492	52.0	0	274492
48	275245	52.0	0	275245
49	291661	52.0	0	291661
50	299885	52.0	0	299885
51	313694	52.0	0	313694
52	302227	52.0	0	302227
53	310906	52.0	0	310906
54	308786	52.0	0	308786
55	321554	52.0	0	321554
56	327071	52.0	0	327071
57	336415	52.0	0	336415
58	341971	52.0	0	341971
59	346026	52.0	0	346026
60	347628	52.0	0	347628
61	338778	52.0	0	338778
62	340512	52.0	0	340512
63	365216	52.0	0	365216
64	419173	52.0	0	419173
65	424161	52.0	0	424161
66	456042	52.0	0	456042
67	482807	52.0	0	482807
68	504748	52.0	0	504748
69	513832	52.0	0	513832
70	522440	52.0	0	522440
71	527338	52.0	0	527338
72	578165	52.0	0	578165
73	509636	52.0	0	509636
74	668833	52.0	0	668833
75	582687	52.0	0	582687
76	504254	52.0	0	504254
77	529474	52.0	0	529474
78	610494	52.0	0	610494
79	551097	52.0	0	551097
80	657423	52.0	0	657423
81	555360	52.0	0	555360
82	592973	52.0	0	592973
83	687019	52.0	0	687019
84	701008	52.0	0	701008
85	705637	52.0	0	705637
86	575381	52.0	0	575381
87	485224	52.0	0	485224
88	596172	52.0	0	596172
89	266801	52.0	0	266801
90	227805	52.0	0	227805
91	64400	52.0	0	64400
92	35706	52.0	0	35706
93	20981	52.0	0	20981
94	22953	52.0	0	22953
95	15963	52.0	0	15963
96	18069	52.0	0	18069
97	14313	52.0	0	14313
98	12689	52.0	0	12689
99	93134	52.0	0	93134
100	10128	52.0	0	10128
101	19883	52.0	0	19883
102	24053	52.0	0	24053
103	19921	52.0	0	19921
104	28056	52.0	0	28056
105	5940	52.0	0	5940
106	25858	52.0	0	25858
107	39367	52.0	0	39367
108	21576	52.0	0	21576
109	15762	52.0	0	15762
110	35058	52.0	0	35058
111	20917	52.0	0	20917
112	16897	52.0	0	16897
113	14573	52.0	0	14573
114	13118	52.0	0	13118
115	13999	52.0	0	13999
116	17251	52.0	0	17251
117	14751	52.0	0	14751
118	11741	52.0	0	11741
119	9263	52.0	0	9263
120	110528	52.0	0	110528
