This is cutadapt 2.10 with Python 3.8.3
Command line parameters: --cores=0 -g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA;max_error_rate=0 --overlap 5 -o ../trimmed_reads/V10F24-110_D1_S4_L001_R2_001.fastq.gz -n 2 sample_S4_R2.fastq.gz
Processing reads on 10 cores in single-end mode ...
Finished in 562.67 s (9 us/read; 6.37 M reads/minute).

=== Summary ===

Total reads processed:              59,752,009
Reads with adapters:                58,913,235 (98.6%)
Reads written (passing filters):    59,752,009 (100.0%)

Total basepairs processed: 7,170,241,080 bp
Total written (filtered):  3,848,707,819 bp (53.7%)

=== Adapter 1 ===

Sequence: AAGCAGTGGTATCAACGCAGAGTACATGGG; Type: non-internal 5'; Length: 30; Trimmed: 57885161 times

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30 bp: 3

Overview of removed sequences
length	count	expect	max.err	error counts
5	86508	58351.6	0	86508
6	12672	14587.9	0	12672
7	12925	3647.0	0	12925
8	3454	911.7	0	3454
9	1124	227.9	0	414 710
10	3533	57.0	1	1187 2346
11	19919	14.2	1	18507 1412
12	2667	3.6	1	1474 1193
13	7136	0.9	1	6592 544
14	4490	0.2	1	4008 482
15	3041	0.1	1	2034 1007
16	10983	0.0	1	8166 2817
17	21416	0.0	1	18694 2722
18	15083	0.0	1	12847 2195 41
19	8586	0.0	1	5632 2702 252
20	17497	0.0	2	14593 2436 468
21	17274	0.0	2	12870 3592 812
22	37716	0.0	2	27764 8206 1746
23	68110	0.0	2	58848 6946 2316
24	34522	0.0	2	9310 20063 5149
25	255784	0.0	2	192491 51435 11858
26	384237	0.0	2	275494 83271 25472
27	885340	0.0	2	474105 334098 61211 15926
28	3482870	0.0	2	2811923 502638 160814 7495
29	5329860	0.0	2	1497531 3642263 162551 27515
30	45293461	0.0	3	43474199 1381602 327278 110382
31	721135	0.0	3	0 605256 88869 27010
32	557769	0.0	3	0 0 485916 71853
33	586049	0.0	3	0 0 0 586049


=== Adapter 2 ===

Sequence: AAAAAAAAAA; Type: regular 3'; Length: 10; Trimmed: 28224115 times

No. of allowed errors:
0-10 bp: 0

Bases preceding removed adapters:
  A: 0.0%
  C: 36.9%
  G: 31.4%
  T: 31.6%
  none/other: 0.0%

Overview of removed sequences
length	count	expect	max.err	error counts
5	299989	58351.6	0	299989
6	232957	14587.9	0	232957
7	199329	3647.0	0	199329
8	192739	911.7	0	192739
9	190093	227.9	0	190093
10	183284	57.0	0	183284
11	178445	57.0	0	178445
12	191952	57.0	0	191952
13	192934	57.0	0	192934
14	200524	57.0	0	200524
15	193509	57.0	0	193509
16	201181	57.0	0	201181
17	203013	57.0	0	203013
18	208182	57.0	0	208182
19	202339	57.0	0	202339
20	207380	57.0	0	207380
21	202957	57.0	0	202957
22	204888	57.0	0	204888
23	204135	57.0	0	204135
24	204022	57.0	0	204022
25	210635	57.0	0	210635
26	228626	57.0	0	228626
27	217167	57.0	0	217167
28	226204	57.0	0	226204
29	222388	57.0	0	222388
30	215896	57.0	0	215896
31	239073	57.0	0	239073
32	221306	57.0	0	221306
33	234024	57.0	0	234024
34	243707	57.0	0	243707
35	229741	57.0	0	229741
36	236947	57.0	0	236947
37	243598	57.0	0	243598
38	251129	57.0	0	251129
39	248684	57.0	0	248684
40	258460	57.0	0	258460
41	292667	57.0	0	292667
42	281154	57.0	0	281154
43	263905	57.0	0	263905
44	265097	57.0	0	265097
45	262616	57.0	0	262616
46	331784	57.0	0	331784
47	267849	57.0	0	267849
48	268356	57.0	0	268356
49	278992	57.0	0	278992
50	283749	57.0	0	283749
51	300768	57.0	0	300768
52	283450	57.0	0	283450
53	293437	57.0	0	293437
54	290634	57.0	0	290634
55	301781	57.0	0	301781
56	309811	57.0	0	309811
57	317899	57.0	0	317899
58	318127	57.0	0	318127
59	325420	57.0	0	325420
60	325686	57.0	0	325686
61	315818	57.0	0	315818
62	316896	57.0	0	316896
63	334508	57.0	0	334508
64	388574	57.0	0	388574
65	385495	57.0	0	385495
66	416773	57.0	0	416773
67	438354	57.0	0	438354
68	464169	57.0	0	464169
69	466039	57.0	0	466039
70	475301	57.0	0	475301
71	478187	57.0	0	478187
72	530106	57.0	0	530106
73	457715	57.0	0	457715
74	601630	57.0	0	601630
75	523708	57.0	0	523708
76	451144	57.0	0	451144
77	468004	57.0	0	468004
78	540482	57.0	0	540482
79	485021	57.0	0	485021
80	568741	57.0	0	568741
81	482592	57.0	0	482592
82	518721	57.0	0	518721
83	600710	57.0	0	600710
84	606169	57.0	0	606169
85	620960	57.0	0	620960
86	500566	57.0	0	500566
87	415692	57.0	0	415692
88	511530	57.0	0	511530
89	228415	57.0	0	228415
90	198968	57.0	0	198968
91	55437	57.0	0	55437
92	30731	57.0	0	30731
93	18963	57.0	0	18963
94	20551	57.0	0	20551
95	14984	57.0	0	14984
96	18444	57.0	0	18444
97	15090	57.0	0	15090
98	11850	57.0	0	11850
99	79934	57.0	0	79934
100	8729	57.0	0	8729
101	17898	57.0	0	17898
102	23890	57.0	0	23890
103	18483	57.0	0	18483
104	25550	57.0	0	25550
105	5318	57.0	0	5318
106	22754	57.0	0	22754
107	36190	57.0	0	36190
108	20535	57.0	0	20535
109	15729	57.0	0	15729
110	33668	57.0	0	33668
111	18781	57.0	0	18781
112	14722	57.0	0	14722
113	12969	57.0	0	12969
114	11424	57.0	0	11424
115	12080	57.0	0	12080
116	15392	57.0	0	15392
117	13462	57.0	0	13462
118	10457	57.0	0	10457
119	8785	57.0	0	8785
120	135708	57.0	0	135708
