This is cutadapt 2.10 with Python 3.8.3
Command line parameters: --cores=0 -g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA;max_error_rate=0 --overlap 5 -o ../trimmed_reads/V10F24-110_A1_S1_L001_R2_001.fastq.gz -n 2 sample_S1_R2.fastq.gz
Processing reads on 10 cores in single-end mode ...
Finished in 642.83 s (11 us/read; 5.48 M reads/minute).

=== Summary ===

Total reads processed:              58,660,419
Reads with adapters:                56,863,660 (96.9%)
Reads written (passing filters):    58,660,419 (100.0%)

Total basepairs processed: 7,039,250,280 bp
Total written (filtered):  4,536,816,240 bp (64.5%)

=== Adapter 1 ===

Sequence: AAGCAGTGGTATCAACGCAGAGTACATGGG; Type: non-internal 5'; Length: 30; Trimmed: 56078286 times

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30 bp: 3

Overview of removed sequences
length	count	expect	max.err	error counts
5	53169	57285.6	0	53169
6	13684	14321.4	0	13684
7	10414	3580.3	0	10414
8	3102	895.1	0	3102
9	1149	223.8	0	490 659
10	3236	55.9	1	1630 1606
11	16428	14.0	1	15689 739
12	2297	3.5	1	1548 749
13	5879	0.9	1	5509 370
14	3739	0.2	1	3377 362
15	2163	0.1	1	1671 492
16	6772	0.0	1	5367 1405
17	13281	0.0	1	11833 1448
18	10693	0.0	1	9152 1491 50
19	6454	0.0	1	4059 2174 221
20	15934	0.0	2	13642 1954 338
21	12229	0.0	2	8855 2616 758
22	29984	0.0	2	22914 5704 1366
23	55367	0.0	2	47779 5743 1845
24	25565	0.0	2	8190 13330 4045
25	218619	0.0	2	170798 38652 9169
26	328021	0.0	2	244911 61526 21584
27	712436	0.0	2	398245 241665 49920 22606
28	3321451	0.0	2	2682609 459259 169797 9786
29	4232617	0.0	2	1611527 2470367 127637 23086
30	45331099	0.0	3	43589053 1327604 303889 110553
31	834146	0.0	3	0 689687 107174 37285
32	395846	0.0	3	0 0 332778 63068
33	412512	0.0	3	0 0 0 412512


=== Adapter 2 ===

Sequence: AAAAAAAAAA; Type: regular 3'; Length: 10; Trimmed: 16405176 times

No. of allowed errors:
0-10 bp: 0

Bases preceding removed adapters:
  A: 0.0%
  C: 33.0%
  G: 27.5%
  T: 39.4%
  none/other: 0.0%

Overview of removed sequences
length	count	expect	max.err	error counts
5	279804	57285.6	0	279804
6	195635	14321.4	0	195635
7	168376	3580.3	0	168376
8	154181	895.1	0	154181
9	144922	223.8	0	144922
10	140852	55.9	0	140852
11	146710	55.9	0	146710
12	140710	55.9	0	140710
13	158415	55.9	0	158415
14	283995	55.9	0	283995
15	179939	55.9	0	179939
16	172337	55.9	0	172337
17	156066	55.9	0	156066
18	159359	55.9	0	159359
19	175204	55.9	0	175204
20	178601	55.9	0	178601
21	191763	55.9	0	191763
22	166902	55.9	0	166902
23	160063	55.9	0	160063
24	160142	55.9	0	160142
25	154047	55.9	0	154047
26	152506	55.9	0	152506
27	152478	55.9	0	152478
28	158517	55.9	0	158517
29	161581	55.9	0	161581
30	157610	55.9	0	157610
31	159515	55.9	0	159515
32	154700	55.9	0	154700
33	164821	55.9	0	164821
34	172656	55.9	0	172656
35	181562	55.9	0	181562
36	171719	55.9	0	171719
37	175875	55.9	0	175875
38	180106	55.9	0	180106
39	172061	55.9	0	172061
40	169036	55.9	0	169036
41	166805	55.9	0	166805
42	164315	55.9	0	164315
43	164741	55.9	0	164741
44	163770	55.9	0	163770
45	166069	55.9	0	166069
46	168131	55.9	0	168131
47	173628	55.9	0	173628
48	168948	55.9	0	168948
49	173174	55.9	0	173174
50	175553	55.9	0	175553
51	184136	55.9	0	184136
52	184514	55.9	0	184514
53	183461	55.9	0	183461
54	176074	55.9	0	176074
55	182417	55.9	0	182417
56	185169	55.9	0	185169
57	179662	55.9	0	179662
58	180276	55.9	0	180276
59	182951	55.9	0	182951
60	179786	55.9	0	179786
61	182728	55.9	0	182728
62	181286	55.9	0	181286
63	186740	55.9	0	186740
64	186527	55.9	0	186527
65	187852	55.9	0	187852
66	192106	55.9	0	192106
67	200294	55.9	0	200294
68	200936	55.9	0	200936
69	210765	55.9	0	210765
70	207084	55.9	0	207084
71	193241	55.9	0	193241
72	201697	55.9	0	201697
73	201288	55.9	0	201288
74	246067	55.9	0	246067
75	237154	55.9	0	237154
76	232760	55.9	0	232760
77	228980	55.9	0	228980
78	251251	55.9	0	251251
79	239064	55.9	0	239064
80	243380	55.9	0	243380
81	250636	55.9	0	250636
82	274631	55.9	0	274631
83	292598	55.9	0	292598
84	268139	55.9	0	268139
85	240932	55.9	0	240932
86	203339	55.9	0	203339
87	186299	55.9	0	186299
88	179910	55.9	0	179910
89	148469	55.9	0	148469
90	74766	55.9	0	74766
91	29319	55.9	0	29319
92	16055	55.9	0	16055
93	11755	55.9	0	11755
94	14655	55.9	0	14655
95	9179	55.9	0	9179
96	11679	55.9	0	11679
97	8818	55.9	0	8818
98	7468	55.9	0	7468
99	51211	55.9	0	51211
100	6109	55.9	0	6109
101	11422	55.9	0	11422
102	17192	55.9	0	17192
103	12186	55.9	0	12186
104	15768	55.9	0	15768
105	3783	55.9	0	3783
106	13284	55.9	0	13284
107	20844	55.9	0	20844
108	11957	55.9	0	11957
109	9309	55.9	0	9309
110	21621	55.9	0	21621
111	11934	55.9	0	11934
112	8950	55.9	0	8950
113	8195	55.9	0	8195
114	7335	55.9	0	7335
115	7791	55.9	0	7791
116	9922	55.9	0	9922
117	8203	55.9	0	8203
118	6147	55.9	0	6147
119	4888	55.9	0	4888
120	40932	55.9	0	40932
