This is cutadapt 2.10 with Python 3.8.3
Command line parameters: --cores=0 -g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA;max_error_rate=0 --overlap 5 -o ../trimmed_reads/V10F24-110_B1_S2_L001_R2_001.fastq.gz -n 2 sample_S2_R2.fastq.gz
Processing reads on 10 cores in single-end mode ...
Finished in 675.53 s (11 us/read; 5.38 M reads/minute).

=== Summary ===

Total reads processed:              60,521,648
Reads with adapters:                58,308,119 (96.3%)
Reads written (passing filters):    60,521,648 (100.0%)

Total basepairs processed: 7,262,597,760 bp
Total written (filtered):  4,843,706,349 bp (66.7%)

=== Adapter 1 ===

Sequence: AAGCAGTGGTATCAACGCAGAGTACATGGG; Type: non-internal 5'; Length: 30; Trimmed: 57491324 times

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30 bp: 3

Overview of removed sequences
length	count	expect	max.err	error counts
5	52784	59103.2	0	52784
6	16168	14775.8	0	16168
7	12799	3693.9	0	12799
8	3629	923.5	0	3629
9	1173	230.9	0	556 617
10	3557	57.7	1	1557 2000
11	20342	14.4	1	19417 925
12	2527	3.6	1	1736 791
13	7225	0.9	1	6744 481
14	4681	0.2	1	4216 465
15	2688	0.1	1	2012 676
16	9858	0.0	1	7699 2159
17	19673	0.0	1	17414 2259
18	14856	0.0	1	12498 2286 72
19	8667	0.0	1	5285 3047 335
20	20021	0.0	2	16816 2683 522
21	16731	0.0	2	12315 3410 1006
22	36677	0.0	2	27215 7605 1857
23	73860	0.0	2	63719 7731 2410
24	32046	0.0	2	9217 17211 5618
25	298914	0.0	2	233040 52739 13135
26	441772	0.0	2	328999 83573 29200
27	914592	0.0	2	535396 288911 64658 25627
28	3985588	0.0	2	3220459 561718 192150 11261
29	4302328	0.0	2	1806056 2331498 139639 25135
30	45525694	0.0	3	43678378 1397122 329392 120802
31	865973	0.0	3	0 703836 118887 43250
32	398021	0.0	3	0 0 331316 66705
33	398480	0.0	3	0 0 0 398480


=== Adapter 2 ===

Sequence: AAAAAAAAAA; Type: regular 3'; Length: 10; Trimmed: 14185994 times

No. of allowed errors:
0-10 bp: 0

Bases preceding removed adapters:
  A: 0.0%
  C: 33.0%
  G: 27.9%
  T: 39.1%
  none/other: 0.0%

Overview of removed sequences
length	count	expect	max.err	error counts
5	276499	59103.2	0	276499
6	185265	14775.8	0	185265
7	156163	3693.9	0	156163
8	139864	923.5	0	139864
9	131115	230.9	0	131115
10	126273	57.7	0	126273
11	129446	57.7	0	129446
12	128201	57.7	0	128201
13	142772	57.7	0	142772
14	279382	57.7	0	279382
15	168678	57.7	0	168678
16	157495	57.7	0	157495
17	142113	57.7	0	142113
18	143426	57.7	0	143426
19	157052	57.7	0	157052
20	163823	57.7	0	163823
21	173755	57.7	0	173755
22	148413	57.7	0	148413
23	143539	57.7	0	143539
24	143069	57.7	0	143069
25	135759	57.7	0	135759
26	135767	57.7	0	135767
27	133296	57.7	0	133296
28	137577	57.7	0	137577
29	141796	57.7	0	141796
30	139909	57.7	0	139909
31	139899	57.7	0	139899
32	135975	57.7	0	135975
33	143576	57.7	0	143576
34	149627	57.7	0	149627
35	158011	57.7	0	158011
36	152160	57.7	0	152160
37	154368	57.7	0	154368
38	158206	57.7	0	158206
39	150315	57.7	0	150315
40	145213	57.7	0	145213
41	144751	57.7	0	144751
42	142345	57.7	0	142345
43	140973	57.7	0	140973
44	142143	57.7	0	142143
45	141950	57.7	0	141950
46	144010	57.7	0	144010
47	147839	57.7	0	147839
48	144828	57.7	0	144828
49	147793	57.7	0	147793
50	151237	57.7	0	151237
51	157588	57.7	0	157588
52	155319	57.7	0	155319
53	155041	57.7	0	155041
54	150482	57.7	0	150482
55	152667	57.7	0	152667
56	153541	57.7	0	153541
57	152413	57.7	0	152413
58	152089	57.7	0	152089
59	153280	57.7	0	153280
60	150986	57.7	0	150986
61	150518	57.7	0	150518
62	150826	57.7	0	150826
63	154416	57.7	0	154416
64	154386	57.7	0	154386
65	156984	57.7	0	156984
66	157857	57.7	0	157857
67	161247	57.7	0	161247
68	162901	57.7	0	162901
69	171239	57.7	0	171239
70	166323	57.7	0	166323
71	155908	57.7	0	155908
72	164196	57.7	0	164196
73	164597	57.7	0	164597
74	196077	57.7	0	196077
75	191679	57.7	0	191679
76	186622	57.7	0	186622
77	188441	57.7	0	188441
78	202958	57.7	0	202958
79	196130	57.7	0	196130
80	202132	57.7	0	202132
81	204243	57.7	0	204243
82	223472	57.7	0	223472
83	239926	57.7	0	239926
84	219294	57.7	0	219294
85	198286	57.7	0	198286
86	168211	57.7	0	168211
87	152554	57.7	0	152554
88	149677	57.7	0	149677
89	128975	57.7	0	128975
90	78149	57.7	0	78149
91	30143	57.7	0	30143
92	17295	57.7	0	17295
93	12519	57.7	0	12519
94	15560	57.7	0	15560
95	9542	57.7	0	9542
96	11946	57.7	0	11946
97	9516	57.7	0	9516
98	7633	57.7	0	7633
99	51115	57.7	0	51115
100	6394	57.7	0	6394
101	11237	57.7	0	11237
102	16500	57.7	0	16500
103	12206	57.7	0	12206
104	16369	57.7	0	16369
105	3935	57.7	0	3935
106	13550	57.7	0	13550
107	21471	57.7	0	21471
108	12135	57.7	0	12135
109	9657	57.7	0	9657
110	21019	57.7	0	21019
111	12701	57.7	0	12701
112	10048	57.7	0	10048
113	8597	57.7	0	8597
114	7838	57.7	0	7838
115	8121	57.7	0	8121
116	10367	57.7	0	10367
117	8357	57.7	0	8357
118	6282	57.7	0	6282
119	5011	57.7	0	5011
120	71634	57.7	0	71634
