Biological sequences are arguably the central object in Bioinformatics, and in this chapter we’ll introduce the Biopython mechanism for dealing with sequences, the Seq object.
In Chapter 4 on Sequence Input/Output (and Section 10.1), we’ll see that the Seq object is also used in the SeqRecord object, which combines the sequence information with any annotation.
Sequences are essentially strings of letters like AGTACACTGGT, which seems very natural since this is the most common way that sequences are seen in biological file formats.
There are two important differences between the Seq object and standard python strings. First of all the Seq object has a slightly different set of methods to a plain python string (for example, a reverse_complement() method used for nucleotide sequences).
Secondly, the Seq object has an important attribute, alphabet, which is an object describing what the individual characters making up the sequence string “mean”, and how they should be interpreted. For example, is AGTACACTGGT a DNA sequence, or just a protein sequence that happens to be rich in Alanines, Glycines, Cysteines
and Threonines?
The alphabet object is perhaps the important thing that makes the Seq object more than just a string. The currently available alphabets for Biopython are defined in the Bio.Alphabet module. We’ll use the IUPAC alphabets (http://www.chem.qmw.ac.uk/iupac/) here to deal with some of our favorite objects: DNA, RNA and Proteins.
Bio.Alphabet.IUPAC provides basic definitions for proteins, DNA and RNA, but additionally provides the ability to extend and customize the basic definitions. For instance, for proteins, there is a basic IUPACProtein class, but there is an additional ExtendedIUPACProtein class providing for the additional elements “Asx” (asparagine or aspartic acid), “Sec” (selenocysteine), and “Glx” (glutamine or glutamic acid). For DNA you’ve got choices of IUPACUnambiguousDNA, which provides for just the basic letters, IUPACAmbiguousDNA (which provides for ambiguity letters for every possible situation) and ExtendedIUPACDNA, which allows letters for modified bases. Similarly, RNA can be represented by IUPACAmbiguousRNA or IUPACUnambiguousRNA.
The advantages of having an alphabet class are two fold. First, this gives an idea of the type of information the Seq object contains. Secondly, this provides a means of constraining the information, as a means of type checking.
Now that we know what we are dealing with, let’s look at how to utilize this class to do interesting work. You can create an ambiguous sequence with the default generic alphabet like this:
>>> from Bio.Seq import Seq
>>> my_seq = Seq("AGTACACTGGT")
>>> my_seq
Seq('AGTACACTGGT', Alphabet())
>>> my_seq.alphabet
Alphabet()
However, where possible you should specify the alphabet explicitly when creating your sequence objects - in this case an unambiguous DNA alphabet object:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> my_seq = Seq('AGTACACTGGT', IUPAC.unambiguous_dna)
>>> my_seq
Seq('AGTACACTGGT', IUPACUnambiguousDNA())
>>> my_seq.alphabet
IUPACUnambiguousDNA()
In many ways, we can deal with Seq objects as if they were normal python strings, for example getting the length, or iterating over the elements:
from Bio.Seq import Seq
from Bio.Alphabet import IUPAC
my_seq = Seq('GATCGATGGGCCTATATAGGATCGAAAATCGC', IUPAC.unambiguous_dna)
for index, letter in enumerate(my_seq) :
print index, letter
print len(letter)
You can access elements of the sequence in the same way as for strings (but remember, python counts from zero!):
>>> print my_seq[0] #first element >>> print my_seq[2] #third element >>> print my_seq[-1] #list element
The Seq object has a .count() method, just like a string:
>>> len(my_seq)
32
>>> my_seq.count("G")
10
>>> float(my_seq.count("G") + my_seq.count("C")) / len(my_seq)
0.46875
While you could use the above snippet of code to calculate a GC%, note that Biopython does have some GC functions already built in, see the Bio.SeqUtils module.
A more complicated example, let’s get a slice of the sequence:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> my_seq = Seq('GATCGATGGGCCTATATAGGATCGAAAATCGC', IUPAC.unambiguous_dna)
>>> my_seq[4:12]
Seq('GATGGGCC', IUPACUnambiguousDNA())
Two things are interesting to note. First, this follows the normal conventions for python strings. So the first element of the sequence is 0 (which is normal for computer science, but not so normal for biology). When you do a slice the first item is included (i. e. 4 in this case) and the last is excluded (12 in this case), which is the way things work in python, but of course not necessarily the way everyone in the world would expect. The main goal is to stay consistent with what python does.
The second thing to notice is that the slice is performed on the sequence data string, but the new object produced is another Seq object which retains the alphabet information from the original Seq object.
Also like a python string, you can do slices with a start, stop and stride (the step size, which defaults to one). For example, we can get the first, second and third codon positions of this DNA sequence:
>>> my_seq[0::3]
Seq('GCTGTAGTAAG', IUPACUnambiguousDNA())
>>> my_seq[1::3]
Seq('AGGCATGCATC', IUPACUnambiguousDNA())
>>> my_seq[2::3]
Seq('TAGCTAAGAC', IUPACUnambiguousDNA())
Another stride trick you might have seen with a python string is the use of a -1 stride to reverse the string. You can do this with a Seq object too:
>>> my_seq[::-1]
Seq('CGCTAAAAGCTAGGATATATCCGGGTAGCTAG', IUPACUnambiguousDNA())
If you are really do just need a plain string, for example to print out, write to a file, or insert into a database, then this is very easy to get:
>>> my_seq.tostring() 'GATCGATGGGCCTATATAGGATCGAAAATCGC'
For nucleotide sequences, you can easily obtain the complement or reverse complement of a Seq object:
>>> my_seq
Seq('GATCGATGGGCCTATATAGGATCGAAAATCGC', IUPACUnambiguousDNA())
>>> my_seq.complement()
Seq('CTAGCTACCCGGATATATCCTAGCTTTTAGCG', IUPACUnambiguousDNA())
>>> my_seq.reverse_complement()
Seq('GCGATTTTCGATCCTATATAGGCCCATCGATC', IUPACUnambiguousDNA())
In all of these operations, the alphabet property is maintained. This is very useful in case you accidentally end up trying to do something weird like take the (reverse)complement of a protein seuqence:
>>> protein_seq = Seq("EVRNAK", IUPAC.protein)
>>> dna_seq = Seq("ACGT", IUPAC.unambiguous_dna)
>>> protein_seq.complement()
Traceback (most recent call last):
File "<stdin>", line 1, in ?
File "/usr/local/lib/python2.4/site-packages/Bio/Seq.py", line 108, in complement
raise ValueError, "Proteins do not have complements!"
ValueError: Proteins do not have complements!
Naturally, you can in principle add any two Seq objects together - just like you can with python strings to concatenate them. However, you can’t add sequences with incompatible alphabets, such as a protein sequence and a DNA sequence:
>>> protein_seq + dna_seq
Traceback (most recent call last):
File "<stdin>", line 1, in ?
File "/usr/local/lib/python2.4/site-packages/Bio/Seq.py", line 42, in __add__
raise TypeError, ("incompatable alphabets", str(self.alphabet),
TypeError: ('incompatable alphabets', 'IUPACProtein()', 'IUPACUnambiguousDNA()')
If you really wanted to do this, you’d have to first give both sequences generic alphabets:
>>> from Bio.Alphabet import generic_alphabet
>>> protein_seq.alphabet = generic_alphabet
>>> dna_seq.alphabet = generic_alphabet
>>> protein_seq + dna_seq
Seq('EVRNAKACGT', Alphabet())
Here is an example of adding a generic nucleotide sequence to an unambiguous IUPAC DNA sequence, resulting in an ambiguous nucleotide sequence:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_nucleotide
>>> from Bio.Alphabet import IUPAC
>>> nuc_seq = Seq('GATCGATGC', generic_nucleotide)
>>> dna_seq = Seq('ACGT', IUPAC.unambiguous_dna)
>>> nuc_seq
Seq('GATCGATGC', NucleotideAlphabet())
>>> dna_seq
Seq('ACGT', IUPACUnambiguousDNA())
>>> nuc_seq + dna_seq
Seq('GATCGATGCACGT', NucleotideAlphabet())
Just like the normal python string, the Seq object is “read only”, or in python terminology, not mutable. Apart from the wanting the Seq object to act like a string, this is also a useful default since in many biological applications you want to ensure you are not changing your sequence data:
>>> my_seq[5] = "G" Traceback (most recent call last): File "<stdin>", line 1, in ? AttributeError: 'Seq' instance has no attribute '__setitem__'
However, you can convert it into a mutable sequence (a MutableSeq object) and do pretty much anything you want with it:
>>> mutable_seq = my_seq.tomutable()
>>> print mutable_seq
MutableSeq('GATCGATGGGCCTATATAGGATCGAAAATCGC', IUPACUnambiguousDNA())
>>> mutable_seq[5] = "T"
>>> print mutable_seq
MutableSeq('GATCGTTGGGCCTATATAGGATCGAAAATCGC', IUPACUnambiguousDNA())
>>> mutable_seq.remove("T")
>>> print mutable_seq
MutableSeq('GACGTTGGGCCTATATAGGATCGAAAATCGC', IUPACUnambiguousDNA())
>>> mutable_seq.reverse()
>>> print mutable_seq
MutableSeq('CGCTAAAAGCTAGGATATATCCGGGTTGCAG', IUPACUnambiguousDNA())
Now that the nature of the sequence object makes some sense, the next
thing to look at is what kind of things we can do with a sequence. The
Bio directory contains two useful modules to transcribe and
translate a sequence object. These tools work based on the alphabet of
the sequence.
For instance, let’s supposed we want to transcribe a DNA sequence:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> my_seq = Seq("GATCGATGGGCCTATATAGGATCGAAAATCGC", IUPAC.unambiguous_dna)
This contains an unambiguous alphabet, so to transcribe we would do the following:
>>> from Bio import Transcribe
>>> transcriber = Transcribe.unambiguous_transcriber
>>> my_rna_seq = transcriber.transcribe(my_seq)
>>> print my_rna_seq
Seq('GAUCGAUGGGCCUAUAUAGGAUCGAAAAUCGC', IUPACUnambiguousRNA())
The alphabet of the new RNA Seq object is created for free, so again, dealing with a Seq object is no more difficult then dealing with a simple string.
You can also reverse transcribe RNA sequences:
>>> transcriber.back_transcribe(my_rna_seq)
Seq('GATCGATGGGCCTATATAGGATCGAAAATCGC', IUPACUnambiguousDNA())
To translate our DNA object we have quite a few choices. First, we can use any number of translation tables depending on what we know about our DNA sequence. The translation tables available in biopython were taken from information at ftp://ftp.ncbi.nlm.nih.gov/entrez/misc/data/gc.prt. So, you have tons of choices to pick from. For this, let’s just focus on two choices: the Standard translation table, and the Translation table for Vertebrate Mitochondrial DNA. These tables are labeled with id numbers 1 and 2, respectively. Now that we know what tables we are looking to get, we’re all set to perform a basic translation. First, we need to get our translators that use these tables. Since we are still dealing with our unambiguous DNA object, we want to fetch translators that take this into account:
>>> from Bio import Translate >>> standard_translator = Translate.unambiguous_dna_by_id[1] >>> mito_translator = Translate.unambiguous_dna_by_id[2]
Once we’ve got the proper translators, it’s time to go ahead and translate a sequence:
>>> my_seq = Seq("GCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA", IUPAC.unambiguous_dna)
>>> standard_translator.translate(my_seq)
Seq('AIVMGR*KGAR', IUPACProtein())
>>> mito_translator.translate(my_seq)
Seq('AIVMGRWKGAR', IUPACProtein())
Notice that the default translation will just go ahead and proceed blindly through a stop codon. If you are aware that you are translating some kind of open reading frame and want to just see everything up until the stop codon, this can be easily done with the translate_to_stop function:
>>> standard_translator.translate_to_stop(my_seq)
Seq('AIVMGR', IUPACProtein())
Similar to the transcriber, it is also possible to reverse translate a protein into a DNA sequence:
>>> my_protein = Seq("AVMGRWKGGRAAG", IUPAC.protein)
>>> standard_translator.back_translate(my_protein)
Seq('GCTGTTATGGGTCGTTGGAAGGGTGGTCGTGCTGCTGGT', IUPACUnambiguousDNA())
To close this chapter, for those you who really don’t want to use the sequence objects, there are a few module level functions in Bio.Seq which will accept plain python strings (or Seq objects or MutableSeq objects):
>>> from Bio.Seq import reverse_complement, transcribe, back_transcribe, translate >>> my_string = "GCTGTTATGGGTCGTTGGAAGGGTGGTCGTGCTGCTGGTTAG" >>> reverse_complement(my_string) 'CTAACCAGCAGCACGACCACCCTTCCAACGACCCATAACAGC' >>> transcribe(my_string) 'GCUGUUAUGGGUCGUUGGAAGGGUGGUCGUGCUGCUGGUUAG' >>> back_transcribe(my_string) 'GCTGTTATGGGTCGTTGGAAGGGTGGTCGTGCTGCTGGTTAG' >>> translate(my_string) 'AVMGRWKGGRAAG*'
You are however, encouraged to work with the Seq object by default.